Sequence ID | >WENV170705212 |
Genome ID | LLEQ01000226 |
Phylum/Class | [LLEQ] bioreactor metagenome; day86 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 3184 |
End posion on genome | 3110 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
accaccaaat |
tRNA gene sequence |
GCCGTCGTAGCTCAGCGGGAGAGCGCCATATTGGTAATATGGAGGTCAGGAGTTCTATCC |
Downstream region at tRNA end position |
ttacttcact |
Secondary structure (Cloverleaf model) | >WENV170705212 Thr GGT t ACCA ttacttcact G - C C - G C - G G - C T T C - G G - C C T T T C C T C A G A A | | | | | T C C T C G A G G A G C G | | | | T T G G A G C G A G AGGTC C - G C - G A - T T - A A - T T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |