Sequence ID | >WENV170705216 |
Genome ID | LLEQ01000363 |
Phylum/Class | [LLEQ] bioreactor metagenome; day86 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 1937 |
End posion on genome | 2012 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
tctaattttc |
tRNA gene sequence |
GCAGGCGTAGCTCAGTTGGTAGAGCGCCAGATTTCCAATCTGGATGTCGCCGGTTCAAAT |
Downstream region at tRNA end position |
gatttaaatc |
Secondary structure (Cloverleaf model) | >WENV170705216 Gly TCC c TCCA gatttaaatc G - C C - G A C G - C G - C C - G G - C T A T T G G C C A T G A A + | | | | A T C T C G G C C G G C G | | | | T T G G A G C T A G ATGTC C - G C - G A - T G - C A - T T A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |