Sequence ID | >WENV170705221 |
Genome ID | LLEQ01000383 |
Phylum/Class | [LLEQ] bioreactor metagenome; day86 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 5334 |
End posion on genome | 5408 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
catcgttatg |
tRNA gene sequence |
AGCCACGTGGCGGAGTGGTGACGCAGCGGATTGCAAATCCGTGTACCCCCGGTTCGATTC |
Downstream region at tRNA end position |
acttccaaat |
Secondary structure (Cloverleaf model) | >WENV170705221 Cys GCA g TCCA acttccaaat A C G - C C - G C - G A - T C - G G - C T T T G G G C C A G A G | | | | | G T G G C G C C C G G C G | | | T T G A C G C T G A GTACC G + T C - G G - C G - C A - T T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |