Sequence ID | >WENV170705222 |
Genome ID | LLEQ01000433 |
Phylum/Class | [LLEQ] bioreactor metagenome; day86 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 3905 |
End posion on genome | 3830 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
caccttttgt |
tRNA gene sequence |
GGGGCCATAGCTCAGCTGGGAGAGCGCTTCGCTGGCAGCGAAGAGGTCGTCGGTTCGATC |
Downstream region at tRNA end position |
aatacctgtc |
Secondary structure (Cloverleaf model) | >WENV170705222 Ala GGC t ACCA aatacctgtc G - C G - C G + T G - C C - G C - G A - T C T T C T G C C A C G A A | | | | G T C T C G G T C G G C G | | | | T T G G A G C G A G AGGTC C - G T - A T - A C - G G - C C G T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |