Sequence ID | >WENV170705225 |
Genome ID | LLEQ01000465 |
Phylum/Class | [LLEQ] bioreactor metagenome; day86 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 2602 |
End posion on genome | 2519 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
cccacagctg |
tRNA gene sequence |
GCCCGAGTGGTGGAATGGTAGACGCAGCGGATTCAAAATCCGCCGCCGCGAGGCGTGCGA |
Downstream region at tRNA end position |
gcttgaaatt |
Secondary structure (Cloverleaf model) | >WENV170705225 Leu CAA g ACCA gcttgaaatt G - C C - G C - G C - G G - C A - T G - C T G T C G C T C A T A A G | | | | | G G G G T G G C G A G C G | + | T T T A C G C A G A CGCCGCGAGGCGT G - C C - G G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |