Sequence ID | >WENV170705228 |
Genome ID | LLEQ01000521 |
Phylum/Class | [LLEQ] bioreactor metagenome; day86 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 1902 |
End posion on genome | 1993 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
gctgttttac |
tRNA gene sequence |
GGAGGCGTGGCAGAGTGGTTTAATGCAGCGGTCTTGAAAACCGCCGGGCGGCTCAAACCG |
Downstream region at tRNA end position |
aaacctgaaa |
Secondary structure (Cloverleaf model) | >WENV170705228 Ser TGA c GCCA aaacctgaaa G - C G - C A - T G - C G - C C - G G - C T A T G A C C C A T G A G | | | | | G G G A C G C T G G G C G | | | T T T A T G C T T A A CGGGCGGCTCAAACCGTCCC G - C C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |