Sequence ID | >WENV170705250 |
Genome ID | LLEQ01001373 |
Phylum/Class | [LLEQ] bioreactor metagenome; day86 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 2621 |
End posion on genome | 2694 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
gaatgatgac |
tRNA gene sequence |
GCGGGTGTAGCTCAATGGTAGAGCCACTGCCTTCCAAGCAGAAGACGAGGGTTCGATTCC |
Downstream region at tRNA end position |
tcaccctcgc |
Secondary structure (Cloverleaf model) | >WENV170705250 Gly TCC c TCCA tcaccctcgc G - C C - G G - C G + T G - C T + G G + T T T T C T C C C A A A A | | | | | G T C T C G G A G G G C G | | | | T T G G A G C T A C AGAC A A C - G T - A G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |