Sequence ID | >WENV170705256 |
Genome ID | LLEQ01001456 |
Phylum/Class | [LLEQ] bioreactor metagenome; day86 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 304 |
End posion on genome | 390 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
aacgccagat |
tRNA gene sequence |
GCGGGCGTGATGGAATGGTAGACATACCAGACTTAAAATCTGTTGGGCCTTGTGCCCGTG |
Downstream region at tRNA end position |
ccacaatttc |
Secondary structure (Cloverleaf model) | >WENV170705256 Leu TAA t ACCA ccacaatttc G - C C - G G - C G - C G - C C - G G - C T C T C A C C C A T A A G | | | | | G G G G T A G T G G G C G | | | T T T A C A T A G A TGGGCCTTGTGCCCGT C T C - G A - T G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |