Sequence ID | >WENV170705257 |
Genome ID | LLEQ01001488 |
Phylum/Class | [LLEQ] bioreactor metagenome; day86 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 1913 |
End posion on genome | 1830 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
cgcgcaggat |
tRNA gene sequence |
GCGGGTGTGGCGGAATTGGTAGACGCACCAGATTTAGGTTCTGGCGCCTTTGGCGTGGGG |
Downstream region at tRNA end position |
ttttgatttc |
Secondary structure (Cloverleaf model) | >WENV170705257 Leu TAG t ACCA ttttgatttc G - C C - G G - C G - C G - C T - A G - C T G T T T C C C A T A A G + + | | | G T G G C G G G G G G C G | | | T T G A C G C T A G A CGCCTTTGGCGT C - G C - G A - T G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |