Sequence ID | >WENV170705269 |
Genome ID | LLEQ01002036 |
Phylum/Class | [LLEQ] bioreactor metagenome; day86 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 1768 |
End posion on genome | 1695 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
gtcggtcgcg |
tRNA gene sequence |
GCGGGTATGATGTAATGGTAGCCTGTCAGCTTCCCAAGCTGAACGCGCGGGTTCGATTCC |
Downstream region at tRNA end position |
atccacaccc |
Secondary structure (Cloverleaf model) | >WENV170705269 Gly CCC g TCCA atccacaccc G - C C - G G - C G - C G - C T - A A - T T T T C G C C C A A A G | | | | | G T T G T A G C G G G C G + | | T T G G C C T T A G ACGC T - A C - G A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |