Sequence ID | >WENV170705273 |
Genome ID | LLEQ01002467 |
Phylum/Class | [LLEQ] bioreactor metagenome; day86 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 620 |
End posion on genome | 703 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
ctcagcgtca |
tRNA gene sequence |
GGGCGACGTGCTGCAAGGTGCGGCAGCGGACTGTAACTCCGCCGGGGAGACCCACGCCTG |
Downstream region at tRNA end position |
ttcccccctc |
Secondary structure (Cloverleaf model) | >WENV170705273 Tyr GTA a ACCA ttcccccctc G - C G - C G - C C - G G - C A - T C - G T T G G G A C C A A C T | | | | | G A G T C G C C T G G C G | + | | T T G C G G C T G A CGGGGAGACCCACG G - C C - G G - C G - C A - T C C T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |