Sequence ID | >WENV170705290 |
Genome ID | LLEQ01003405 |
Phylum/Class | [LLEQ] bioreactor metagenome; day86 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 942 |
End posion on genome | 853 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
tccctgacgc |
tRNA gene sequence |
GGAGAGGTGGCAGAGTGGTCGAATGCGGCGGTCTCGAAAACCGTTGTCGGTGAGAGCCGA |
Downstream region at tRNA end position |
tttacctttg |
Secondary structure (Cloverleaf model) | >WENV170705290 Ser CGA c GCCA tttacctttg G - C G - C A - T G - C A - T G - C G + T T A T G T C C C A T G A G | | | | | G G G A C G C A G G G C G | | | T T T A T G C C G A G TGTCGGTGAGAGCCGACC G + T C - G G - C G - C T - A C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |