Sequence ID | >WENV170705292 |
Genome ID | LLEQ01003784 |
Phylum/Class | [LLEQ] bioreactor metagenome; day86 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 792 |
End posion on genome | 706 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
ggcctcgcac |
tRNA gene sequence |
GCGGGCGTGGCGAAATGGTAGACGCATGGGACTTAAACTCCCTCGGGCGATAAGCCCATG |
Downstream region at tRNA end position |
aaataccctt |
Secondary structure (Cloverleaf model) | >WENV170705292 Leu TAA c ACCA aaataccctt G - C C - G G - C G - C G - C C - G G - C T G T C G G C C A T A A G | | | | | G G A G C G G C C G G C G | | | T T T A C G C A G A CGGGCGATAAGCCCAT T T G - C G - C G - C A - T C C T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |