Sequence ID | >WENV170705308 |
Genome ID | LLEQ01005970 |
Phylum/Class | [LLEQ] bioreactor metagenome; day86 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 296 |
End posion on genome | 380 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
cgcggctctt |
tRNA gene sequence |
GCCCAGATGGCGGAATTGGTAGACGCGCTAGTTTCAGGTACTAGTGCCGCGAGGCGTGGA |
Downstream region at tRNA end position |
cttgcaagca |
Secondary structure (Cloverleaf model) | >WENV170705308 Leu CAG t ACCA cttgcaagca G - C C - G C - G C - G A - T G - C A - T T G T T C T C C A T A A G + | | | | G T G G C G G G A G G C G | | | T T G A C G C T A G G TGCCGCGAGGCGT C - G T - A A - T G - C T - A T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |