Sequence ID | >WENV170705317 |
Genome ID | LLEQ01008276 |
Phylum/Class | [LLEQ] bioreactor metagenome; day86 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 294 |
End posion on genome | 208 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
gcgcttgcca |
tRNA gene sequence |
GCCGGGATGGCGGAATCGGTAGACGCAGCGGACTCAAAATCCGCCGGTGGTAACACTGTG |
Downstream region at tRNA end position |
gatggcagct |
Secondary structure (Cloverleaf model) | >WENV170705317 Leu CAA a ACCA gatggcagct G - C C - G C - G G - C G - C G - C A - T T G T C T C C C A T A A G | | | | | G C G G C G G A G G G C G | | | T T G A C G C T A G A CGGTGGTAACACTGT G - C C - G G - C G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |