Sequence ID | >WENV170705353 |
Genome ID | LLEQ01021797 |
Phylum/Class | [LLEQ] bioreactor metagenome; day86 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 75 |
End posion on genome | 158 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
aataccccct |
tRNA gene sequence |
GGAGGGGTTCCCGAGTGGCCAAAGGGATCAGACTGTAAATCTGACGCTCCGCCTTCGAAG |
Downstream region at tRNA end position |
ttttcaaatg |
Secondary structure (Cloverleaf model) | >WENV170705353 Tyr GTA t ACCA ttttcaaatg G - C G - C A - T G - C G - C G - C G - C T A T C T T C C A T G A T | | | | | G G G C C C G A A G G C G | | | T T C A G G G C A A A CGCTCCGCCTTC T - A C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |