Sequence ID | >WENV170706481 |
Genome ID | LNAP01003440 |
Phylum/Class | [LNAP] soil metagenome; Soil samples (1 kg each in a 20% v/v slurry with milli Q water) were incubated in the dark with |
Species | |
Start position on genome | 13530 |
End posion on genome | 13622 |
Amino Acid | Ile |
Anticodon | TAT |
Upstream region at tRNA start position |
gaatgatcac |
tRNA gene sequence |
GCCCCTGTAGCTCAATGGGTAGAGCAGCGGATTTATATCCCGTCAGCGCCAGATAAGCGG |
Downstream region at tRNA end position |
cgccagcgca |
Secondary structure (Cloverleaf model) | >WENV170706481 Ile TAT c ACCA cgccagcgca G - C C - G C - G C - G C - G T - A G - C C G T C G G C C A T A A A | | | | | G G C T C G G C C G G C G | | | | T T G G A G C T A A CAGCGCCAGATAAGCGGCAAGT G + T C - G G - C G - C A C T T T A T A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |