Sequence ID | >WENV170716606 |
Genome ID | LSQX01005169 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 38494 |
End posion on genome | 38422 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
ttatgaggga |
tRNA gene sequence |
GGGGCCATAGGGTAGCCTGGCATCCTAGGAGACTGGGGGTCTTCTGACCTGCGTTCAAAT |
Downstream region at tRNA end position |
taccattttt |
Secondary structure (Cloverleaf model) | >WENV170716606 Pro TGG a Atcg taccattttt G - C G - C G - C G - C C - G C - G A - T T A T G G C G C A C G A A | + | | | A C T G G G C T G C G C T | + | | T T G A T C C G C T CTGAC A - T G + T G - C A - T G G A G C G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |