Sequence ID | >WENV170716992 |
Genome ID | LSQX01019761 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 7001 |
End posion on genome | 7086 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
tccaaaaagc |
tRNA gene sequence |
GCGGGAGTAACCAAGCGGTCAACGGTGGCAGACTCAAGATCTGTTCGTGCAGACGTTCAG |
Downstream region at tRNA end position |
gaaattctca |
Secondary structure (Cloverleaf model) | >WENV170716992 Leu CAA c ACCT gaaattctca G - C C - G G - C G - C G - C A - T G - C T A T T T C C C A C G A A | + | | | G G A C C A A G G G G C G | | | T T T C G G T C A A G TCGTGCAGACGTTC G + T C - G A - T G - C A - T C A T G C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |