Sequence ID | >WENV170717001 |
Genome ID | LSQX01020126 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 9100 |
End posion on genome | 9010 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
attattatac |
tRNA gene sequence |
GGAGAGATGGTCGAGCCGGTTTAAGGCACCGGTCTTGAAAACCGGCGTGGGTTCACGCTC |
Downstream region at tRNA end position |
attttataga |
Secondary structure (Cloverleaf model) | >WENV170717001 Ser TGA c GCCA attttataga G - C G - C A - T G - C A - T G - C A - T T A T G A C C C A C C G A G | | | | | G G G C T G C T G G G C G | + | T T T A G G C T T A A CGTGGGTTCACGCTCACC C - G C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |