Sequence ID | >WENV170717124 |
Genome ID | LSQX01025188 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 12214 |
End posion on genome | 12144 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
gatataatat |
tRNA gene sequence |
GCGGGTGTAGTTCAATGGTAGAACACTAGCCTTCCAAGCTAGATACGTGGGTTCGATTCC |
Downstream region at tRNA end position |
tatgtggaaa |
Secondary structure (Cloverleaf model) | >WENV170717124 Gly TCC t Ttga tatgtggaaa G - C C - G G - C G - C G - C T - A G - C T T T T A C C C A A A A + | | | | G T C T T G G T G G G C G | | | | T T G G A A C T A A ATAC C - G T - A A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |