Sequence ID | >WENV170717356 |
Genome ID | LSQX01032827 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 41405 |
End posion on genome | 41502 |
Amino Acid | SeC(p) |
Anticodon | TCA |
Upstream region at tRNA start position |
gcttccctaa |
tRNA gene sequence |
GGAAGTGCCAAGGTCACTGGTGGGCCTCCCGGACTTCAAATCCGGTGTGGGGCGCTAAAA |
Downstream region at tRNA end position |
atttactaat |
Secondary structure (Cloverleaf model) | >WENV170717356 SeC(p) TCA a GCCA atttactaat G - C G - C A - T A - T G - C T - A G - C C - G T T C T A C C C A C A C A + | | | | G T T G G A G T G G G C G + | | | T T G G C C T T G G C TGTGGGGCGCTAAAACCGTCCCAG C - G C - G G - C G - C A - T C A T A T C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |