Sequence ID | >WENV170717392 |
Genome ID | LSQX01034062 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 3919 |
End posion on genome | 3992 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
cagcagtaac |
tRNA gene sequence |
GGTTCCTTGGCCAAGTGGTAAGGCAATAGACTGCAACTCTGTGATCATCGGTTCGAATCC |
Downstream region at tRNA end position |
aattggggat |
Secondary structure (Cloverleaf model) | >WENV170717392 Cys GCA c TCCA aattggggat G - C G - C T - A T - A C - G C - G T - A T A T T A G C C A G A G | | | | | G T A C C G A T C G G C G | | | T T G A G G C T A A GATC A - T T + G A - T G - C A - T C C T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |