Sequence ID | >WENV170717639 |
Genome ID | LSQX01044043 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 13451 |
End posion on genome | 13366 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
aacactttat |
tRNA gene sequence |
GCGAGAGTGTTGGAATAGGCAGACAAGCACGTTTCAGAGGCGTGTGTACTTCGTACGTGT |
Downstream region at tRNA end position |
tttaaaatat |
Secondary structure (Cloverleaf model) | >WENV170717639 Leu CAG t ACCA tttaaaatat G - C C - G G - C A - T G - C A - T G - C T C T T A C C C A T A A G + | | | | G A G G T T G T G G G C G | | | T T G A C A A C A G G TGTACTTCGTACGT C - G A - T C - G G - C T + G T G T A C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |