Sequence ID | >WENV170717646 |
Genome ID | LSQX01044392 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 17945 |
End posion on genome | 17871 |
Amino Acid | Arg |
Anticodon | TCG |
Upstream region at tRNA start position |
acccatgagg |
tRNA gene sequence |
GGACCCATGGGGTAGAGGAGATCCTTTTGGGCTTCGAACCCAAGGACGCGGGTTCAATTC |
Downstream region at tRNA end position |
gttcttctgg |
Secondary structure (Cloverleaf model) | >WENV170717646 Arg TCG g GTCA gttcttctgg G - C G - C A - T C - G C - G C - G A - T T T T C G C C C A A G A G | | | | | A G T G G G G C G G G C G | | + T T A T C C T G A T GGAC T - A T - A G - C G - C G - C C A T A T C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |