Sequence ID | >WENV170717709 |
Genome ID | LSQX01046761 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 20134 |
End posion on genome | 20207 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
catataatat |
tRNA gene sequence |
GCGGGTGTAGTTCAATGGTAGAATTCCAGCCTTCCAAGCTGGTTGTGAGGGTTCGATCCC |
Downstream region at tRNA end position |
ttatatnnnn |
Secondary structure (Cloverleaf model) | >WENV170717709 Gly TCC t TCCA ttatatnnnn G - C C - G G - C G - C G - C T - A G - C C T T T T C C C A A A A + | | | | G T C T T G G A G G G C G | | | + T T G G A A T T A T TTGT C - G C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |