Sequence ID | >WENV170717724 |
Genome ID | LSQX01047283 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 2497 |
End posion on genome | 2422 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
cattaaatat |
tRNA gene sequence |
CGCGGGGTGGAGCAGTTGGTAGCTCGTCGGGCTCATAACCCGAAGGTCGTTGGTTCAAGT |
Downstream region at tRNA end position |
atattaaagt |
Secondary structure (Cloverleaf model) | >WENV170717724 Met CAT t ACCA atattaaagt C A G - C C - G G - C G - C G - C G + T T G T C T A C C A T G A G | | | | A T C G A G G T T G G C G | | | | T T G G C T C T A G AGGTC T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |