Sequence ID | >WENV170717854 |
Genome ID | LSQX01052161 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 3174 |
End posion on genome | 3101 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
aacaagacgt |
tRNA gene sequence |
GGCGGGGTGGCAGAGTGGTCATGCAGCGGACTGCAACTCCGTGGACGCCGGTTCGATTCC |
Downstream region at tRNA end position |
atcttgtaaa |
Secondary structure (Cloverleaf model) | >WENV170717854 Cys GCA t TCCA atcttgtaaa G - C G - C C - G G - C G - C G + T G - C T T T C A G C C A G A G | | | | G T G A C G G C C G G C G | | | T T G A T G C T C A GGAC G + T C - G G - C G - C A - T C C T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |