Sequence ID | >WENV170718001 |
Genome ID | LSQX01057785 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 10178 |
End posion on genome | 10092 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
tcaacaccta |
tRNA gene sequence |
CCCGAGGTGGTGAAATTGGTAGACGCGGCGGACTCAAAATCCGCTGTCAGAGATGACGTG |
Downstream region at tRNA end position |
tataaatgaa |
Secondary structure (Cloverleaf model) | >WENV170718001 Leu CAA a ACCA tataaatgaa C - G C - G C - G G - C A - T G - C G - C T G T C A G C C A T A A G | | | | | G T A G T G G T C G G C G | + | T T G A C G C T A G G TGTCAGAGATGACGT G - C C - G G - C G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |