Sequence ID | >WENV170718402 |
Genome ID | LSQX01074337 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 1218 |
End posion on genome | 1146 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
ctactgagaT |
tRNA gene sequence |
GCGGTAATGGTCTAATGGCATGACAGGGGCTTCCCAAGCCTCTAATCCGGGTTCGATCCC |
Downstream region at tRNA end position |
gatttttatg |
Secondary structure (Cloverleaf model) | >WENV170718402 Gly CCC T ATtc gatttttatg G - C C - G G - C G + T T - A A - T A - T C T T G G C C C A A A G | | | | | G T T C T G C C G G G C G | | | T T G T G A C C A A TAAT G - C G + T G - C G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |