Sequence ID | >WENV170718740 |
Genome ID | LSQX01089402 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 2594 |
End posion on genome | 2680 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
gtggtgctca |
tRNA gene sequence |
GGAGGATTCGACTAGCGGCCTATGTCACACGCCTGGAACGCGTGCGGGTAGCAATACCCT |
Downstream region at tRNA end position |
atgactttca |
Secondary structure (Cloverleaf model) | >WENV170718740 Ser GGA a GCag atgactttca G - C G - C A - T G - C G - C A - T T - A T A T C A C C C A C G A C | | | | | A G T C A G G T G G G C G | | | T T C T G T C C T A A CGGGTAGCAATACCCTC C - G A - T C - G G - C C - G C C T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |