Sequence ID | >WENV170718853 |
Genome ID | LSQX01092743 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 3751 |
End posion on genome | 3834 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
ctaatcatta |
tRNA gene sequence |
GCCGGGATGGCGGAAGAGGCAGACGCGCGGGACTTAAAATCCCGTTCTAGCAATAGAGTG |
Downstream region at tRNA end position |
tactctgcgt |
Secondary structure (Cloverleaf model) | >WENV170718853 Leu TAA a Agat tactctgcgt G - C C - G C - G G - C G - C G - C A - T T T T C T C C C A G A A G | | | | | G A G G C G G A G G G C G | | | T T G A C G C C A G G TTCTAGCAATAGAGT C - G G - C G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |