Sequence ID | >WENV170718883 |
Genome ID | LSQX01093623 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 3324 |
End posion on genome | 3395 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
aacacagctt |
tRNA gene sequence |
GCCAAGGTGGCGGAGCGGCCACGCGGTTGACTGCAGATCAACTACACCCCGGTTCAAGTC |
Downstream region at tRNA end position |
gtaatagcgg |
Secondary structure (Cloverleaf model) | >WENV170718883 Cys GCA t Tttg gtaatagcgg G - C C - G C - G A - T A - T G - C G - C T G T G G G C C A G A G | | | | | A C G G C G C C C G G C G | | | T T G A C G C C C G TACAC G - C T - A T - A G - C A - T C A T G G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |