Sequence ID | >WENV170719035 |
Genome ID | LSQX01100045 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 2238 |
End posion on genome | 2149 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
cccacaagac |
tRNA gene sequence |
GGAGAGATGGCGGAGTGGTTGAACGCGCCGGTCTTGAAAACCGGATTCCGCGCAAGCGGA |
Downstream region at tRNA end position |
tccccctcca |
Secondary structure (Cloverleaf model) | >WENV170719035 Ser TGA c GCCA tccccctcca G - C G - C A - T G - C A - T G - C A - T T A T C T C C C A T G A G | + | | | G G G G C G G G G G G C G | | | T T T A C G C T G A G ATTCCGCGCAAGCGGAAC C - G C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |