Sequence ID | >WENV170719179 |
Genome ID | LSQX01104744 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 11241 |
End posion on genome | 11325 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
ttctatacga |
tRNA gene sequence |
GCCGGGATAGTCTAGCCCGGAAAGGCGGTGGCCTTGAAAGCCACTGGTGTTCGCACCTCA |
Downstream region at tRNA end position |
aagaatcatt |
Secondary structure (Cloverleaf model) | >WENV170719179 Ser TGA a GCtc aagaatcatt G - C C - G C - G G - C G - C G - C A - T T A T T C C T C A C G A A | | | | | A C T C T G A G G A G C C | | + | T T G A G G C G A A G TGGTGTTCGCACCTC G - C T - A G - C G - C C - G C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |