Sequence ID | >WENV170719623 |
Genome ID | LSQX01120937 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 1067 |
End posion on genome | 1140 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
tgttgcacaa |
tRNA gene sequence |
AGGGGCATGGTGTAATGGTAACACGTGGGTCTCCAAAACCTTTGTTGAGGGTTCGAGTCC |
Downstream region at tRNA end position |
acaaaacacc |
Secondary structure (Cloverleaf model) | >WENV170719623 Trp CCA a GCCA acaaaacacc A - T G - C G - C G - C G - C C - G A - T T G T C T T C C A A A G | | + | | G T T G T G G A G G G C G | | | | T T G A C A C T A G TGTT T T G + T G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |