Sequence ID | >WENV170719758 |
Genome ID | LSQX01126534 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 2199 |
End posion on genome | 2287 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
tccctctttt |
tRNA gene sequence |
GGAGAGATGCTCGAGTGGTTGAAGAGGCACGCCTGGAAAGCGTGTATACGCCAAAAGTGT |
Downstream region at tRNA end position |
agttaaatag |
Secondary structure (Cloverleaf model) | >WENV170719758 Ser GGA t GCgt agttaaatag G - C G - C A - T G - C A - T G - C A - T T A T C G C C C A T G A G | | | | | G G G C T C G C G G G C G | | | T T T A G A G T G A G TATACGCCAAAAGTGTATC C - G A - T C - G G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |