Sequence ID | >WENV170719780 |
Genome ID | LSQX01127977 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 149 |
End posion on genome | 231 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
aggtacaggc |
tRNA gene sequence |
GCGAGTGTTACCGAGCGGCCAAAGGTGATCGACTCAAGATCGATTCTCGAAGGAGTTCGC |
Downstream region at tRNA end position |
ctcttcgggg |
Secondary structure (Cloverleaf model) | >WENV170719780 Leu CAA c Attt ctcttcgggg G - C C - G G - C A - T G - C T - A G - C T A T C G T C C A C G A T | | | | | G G G C C A G C A G G C G | | | T T C A G G T C A A G TCTCGAAGGAGTTC A - T T - A C - G G - C A - T C A T G C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |