Sequence ID | >WENV170719872 |
Genome ID | LSQX01131975 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 23286 |
End posion on genome | 23359 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
taaaatataa |
tRNA gene sequence |
GGTGCCATAGCTCAGTTGGTAGAGCAAAGGACTGAAAATCCTTGTGTCCCTGGTTCGATT |
Downstream region at tRNA end position |
agaaaaaaat |
Secondary structure (Cloverleaf model) | >WENV170719872 Phe GAA a ACat agaaaaaaat G - C G - C T - A G - C C - G C - G A - T T T T G G C C C A T G A A | | | | G T C T C G C C T G G C G | | | | T T G G A G C T A A GTGTC A - T A - T G - C G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |