Sequence ID | >WENV170720135 |
Genome ID | LSQX01142177 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 3141 |
End posion on genome | 3227 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
taattatatt |
tRNA gene sequence |
GCCCAGATGGTGGAATTGGTAGACACGCCAGGTTGAGGGCCTGGTGGCCGTTTTTGGCTG |
Downstream region at tRNA end position |
cgggttctta |
Secondary structure (Cloverleaf model) | >WENV170720135 Leu GAG t ACtg cgggttctta G - C C - G C - G C - G A - T G - C A - T T G T T G T T C A T A A G + | | | | G T G G T G G C A A G C G | | | T T G A C A C T A G G TGGCCGTTTTTGGCTGT C - G C - G A - T G - C G - C T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |