Sequence ID | >WENV170720214 |
Genome ID | LSQX01145232 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 2101 |
End posion on genome | 2186 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
aattctttgc |
tRNA gene sequence |
GGTGGAGTGTCCGAGTGGCTAAAGGAGGCAGACTGTAAATCTGTTGGCTAACGCCTACGT |
Downstream region at tRNA end position |
agattgttag |
Secondary structure (Cloverleaf model) | >WENV170720214 Tyr GTA c ACCA agattgttag G - C G - C T - A G - C G - C A - T G - C T A T C A A C C A T G A G | | | | | G G G C C T G T T G G C G | | | T T C A G G A T A A G TGGCTAACGCCTAC G + T C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |