Sequence ID | >WENV170720222 |
Genome ID | LSQX01145255 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 11771 |
End posion on genome | 11843 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
tcagaatagt |
tRNA gene sequence |
GCCCGAGTAGCGCAATGGTAGCGCAACCGACTTGTAATCGGTAGGTTAGTGGGTTCGAGT |
Downstream region at tRNA end position |
cctgctattt |
Secondary structure (Cloverleaf model) | >WENV170720222 Thr TGT t Tgtt cctgctattt G - C C - G C - G C - G G - C A - T G - C T G T T C C C C A A A A + | | | G T C G C G G T G G G C G | | | | T T G G C G C T A A AGGTTA A - T C - G C - G G - C A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |