Sequence ID | >WENV170720809 |
Genome ID | LSQX01167195 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 1253 |
End posion on genome | 1179 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
attgctccat |
tRNA gene sequence |
AGCCCCGTCGCCAAGCGGTAAGGCACCTGACTCTGACTCAGGCATTCGGTGGTTCGAATC |
Downstream region at tRNA end position |
catccaagcc |
Secondary structure (Cloverleaf model) | >WENV170720809 Gln CTG t GCCA catccaagcc A - T G - C C - G C - G C - G C - G G - C T A T C T A C C A G A C | + | | | G C A C C G G G T G G C G | | | T T G A G G C T A A CATTC C - G C - G T - A G - C A - T C C T A C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |