Sequence ID | >WENV170720994 |
Genome ID | LSQX01174791 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 26476 |
End posion on genome | 26402 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
acaactctac |
tRNA gene sequence |
AGGGGCGTCGCCAAGCGGTAAGGCAGCAGGTTTTGATCCTGCCATGCGTTGGTTCGAATC |
Downstream region at tRNA end position |
cattacgann |
Secondary structure (Cloverleaf model) | >WENV170720994 Gln TTG c GCCA cattacgann A - T G - C G - C G - C G - C C - G G - C T A T C G A C C A G A C | + | | | G C A C C G G T T G G C G | | | T T G A G G C T A A CATGC G - C C - G A - T G - C G - C T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |