Sequence ID | >WENV170721707 |
Genome ID | LSQX01201322 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 1306 |
End posion on genome | 1389 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
agtcaaaatc |
tRNA gene sequence |
GCGAGGGTTGCCAAGCCAGGTTAACGGCGCAGGGTTTAGGACCCTGTCTCTAGGAGTTCA |
Downstream region at tRNA end position |
ctttttctaa |
Secondary structure (Cloverleaf model) | >WENV170721707 Leu TAG c Attc ctttttctaa G - C C - G G - C A - T G - C G - C G - C T A T T T C C C A C C G A T | | | | | G A A C C G A A G G G C G | | | T T G C G G C T T A A G TCTCTAGGAGTTC C - G A - T G - C G - C G - C T A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |