Sequence ID | >WENV170721756 |
Genome ID | LSQX01202883 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 1308 |
End posion on genome | 1394 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
tagcgcgtca |
tRNA gene sequence |
GCCCGGGTGGCGAAACTGGTATACGCAAGGGATTTAAAATCCCTCGGTGGCAACACCATG |
Downstream region at tRNA end position |
gccagtcgcc |
Secondary structure (Cloverleaf model) | >WENV170721756 Leu TAA a AGCA gccagtcgcc G - C C C C - G C - G G - C G - C G G C T T C G C C C A C A A G | | | | | G T A G C G G C G G G C G | | | T T G A C G C T A T A CGGTGGCAACACCAT A - T G - C G - C G - C A - T T A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |