Sequence ID | >WENV170722009 |
Genome ID | LSQX01212827 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 1708 |
End posion on genome | 1792 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
ggggacattt |
tRNA gene sequence |
GCGGGCGTGGTGGAATTGGTAGACACGCTAGACTTAGGATCTAGTGCCGCGAGGTGTGAG |
Downstream region at tRNA end position |
aaagcagaaa |
Secondary structure (Cloverleaf model) | >WENV170722009 Leu TAG t ACAA aaagcagaaa G - C C - G G - C G - C G - C C - G G - C T G T C T C T C A T A A G | | | | | G T G G T G G A G A G C G | | | T T G A C A C T A G G TGCCGCGAGGTGT C - G T - A A - T G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |