Sequence ID | >WENV170722032 |
Genome ID | LSQX01213391 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 17373 |
End posion on genome | 17445 |
Amino Acid | Arg |
Anticodon | GCG |
Upstream region at tRNA start position |
tcattcttgt |
tRNA gene sequence |
GTCCCGGTAGGGTAGTGGATATCCTAGAAGCCTGCGGAGCTTTTGACCCGGGTTCAAATC |
Downstream region at tRNA end position |
cttgttttgg |
Secondary structure (Cloverleaf model) | >WENV170722032 Arg GCG t GCtt cttgttttgg G - C T + G C - G C - G C - G G - C G - C T A T G G C C C A T G A A | | | | | A G T G G G C C G G G C G | | + T T A T C C T T A A TGAC G + T A - T A - T G - C C - G C A T G G C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |