Sequence ID | >WENV170722100 |
Genome ID | LSQX01216168 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 11431 |
End posion on genome | 11357 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gccgtgctgt |
tRNA gene sequence |
GCCAGAGTAGCTCAGCGGTAGAGCAGGGGACTCATAAGCCCTTGGTCGGGGGTTCGATTC |
Downstream region at tRNA end position |
ctttttcttc |
Secondary structure (Cloverleaf model) | >WENV170722100 Met CAT t ACCA ctttttcttc G - C C - G C - G A - T G - C A - T G - C T T T C T C C C A G A A | + | | | G C C T C G G G G G G C G | | | | T T G G A G C T A A TGGTC G + T G - C G - C G - C A G C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |