Sequence ID | >WENV170722319 |
Genome ID | LSQX01225009 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 23470 |
End posion on genome | 23384 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
aataaagaaT |
tRNA gene sequence |
AGAACTGTGGCAGAGTGGTTATTGCAGCAGATTGCTAATCTGTGGTCGTGAAAACGATCC |
Downstream region at tRNA end position |
aaggtaacaa |
Secondary structure (Cloverleaf model) | >WENV170722319 Ser GCT T GAaa aaggtaacaa A - T G - C A - T A - T C - G T + G G - C T A T C A C C C A T G A G | | | | | G G G A C G G T G G G C G + | | | T T T T T G C T A A GGTCGTGAAAACGATCC G + T C - G A - T G - C A - T T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |